Dismiss Notice
Join Physics Forums Today!
The friendliest, high quality science and math community on the planet! Everyone who loves science is here!

Molecular Biology Q & A

  1. Jan 15, 2004 #1

    Another God

    User Avatar
    Staff Emeritus
    Gold Member

    Post any questions you have about Molecular Biology in here (or anything related...Microbiology, lab techniques, experiments etc). Whether you want to know something specific (What is a nucleotide? for example), or something broad (What are RFLP's? for example). This thread could be useful to everyone whether you are a Molecular Biology student, or just someone who has read an article that refered to some terminology you didn't understand. Ask here and Monique, Ian, myself, or any one of the many other resident 'know it mosts' will try to answer it.

    So, to start it off: I'm curious to find out more about PCR Primer design. Can anyone fill me in some more about Star Activity and annealing temperatures etc.
     
  2. jcsd
  3. Jan 15, 2004 #2

    iansmith

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

    For primer design we use the follow guide line

    18 to 25 nucleotides long. the longer the more specific it will be. I prefer 24 nt.
    45-55% GC - I prefer 50% GC
    Melting temperate around 60 Celcius - I usualy have 57 for 24 nt with 50% GC
    Less than 4 nt of self complementary
    no dimer formation @ 3' end
    G or C @ 3' end - it give a more stringent binding

    software for designing are not necessary I have designing my primer for about two years with any sofware and I have never had a primer not work in normal PCR and Sequencing from PCR produc and Plasmid. Direct Genomic sequencing is a bit more tricky.

    the annealing temperature is calculate using the following formula Tm=4(G+C)+2(A+T). The higher the GC the higher the melting temperature. The melting temperature is when the DNA is seperate. You optimal anneling temperature will be 3-5 C lower than your melting temperature. The higher your anneling temperature, the more stringent it is.
     
  4. Jan 15, 2004 #3

    Monique

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

    I do the same as Ian. Primers 20 nt long, both the same length (+- 1nt) GC closest to 50%, Tm close around 58oC, at will be 2-3 lower, Tm of both primers should be within 3 degree range.

    A cool tool I always use is the Mac program Amplify, which is downloadable from the net. It's a cool tool since it does an in silico PCR and gives you the results of which fragments are going to be amplified and how strong. Very visual, very neat.

    I check the primers GC and Tm in IDT oligoanalyzer http://biotools.idtdna.com/analyzer/.

    Very easy. The picking of the primers I always do by eye, I always put them through Amplify though.. some parts of the genome are just incredibly GC rich and have Alu repeats.. and ofcourse those are the regions I need.. *sigh*
     
  5. Jan 15, 2004 #4

    Monique

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

    Here is Amplify for the Mac
    http://bip.weizmann.ac.il/mb/bioguide/pcr/PCRsofAmplify.html

    If you are not going to use it, at least try it out :) you paste in the sequence which you want to look at, make it large! You paste in the primers you are planning on using, do PCR and out comes a graph of predicted products, their weight and how stabile the primers are on the sequence. It also warns in case of primer dimers.
     
  6. Jan 15, 2004 #5

    Monique

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

    AG, as far as I know star activity only takes place with restriction enzymes. When they are not kept at their optimal temperature, they'll start digesting DNA that isn't their recognition sequence.

    More info:
    http://www.neb.com/neb/frame_tech.html
     
  7. Jan 15, 2004 #6

    iansmith

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

  8. Jan 15, 2004 #7

    Monique

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

    I think the IDT one is better, based on the following sequence:
    GCATGGACTGACGGGGGCCCCAT

    PITT says: 64 oC Tm
    IDT says: 69.4 oC Tm

    I think the IDT algorythm is more complicated and takes into account base to base interactions (several G's following eachother for instance are harder to melt).
     
  9. Jan 15, 2004 #8

    Another God

    User Avatar
    Staff Emeritus
    Gold Member

    Thanks so much for all the info (particularly the Star Activity... I got confused and thought that that was related to Primers... Forgot it was Restriction enzyme effect!!!)

    I think that question has been thoroughly covered now. Next!
     
  10. Jan 15, 2004 #9
    I have a question.

    Could you please explain to me the physiological basis of ticklishness? I am aware that there are free nerve endings in the skin, which respond to touch and are receptor-mediated, releasing neurotransmitters that go to the brain. I cannot find much more detail than this, though. Ticklishness is defined as a sensation separate from itch or pressure, and I am wondering how the body makes the distinction among the different types of touch. Are there individual touch receptors for each? Is it the same receptor but a different neurotransmitter that is released? If you could answer some of my questions or direct me in my research, it would be greatly appreciated.

    Thank you,
    Jeebus
     
  11. Jan 16, 2004 #10

    Monique

    User Avatar
    Staff Emeritus
    Science Advisor
    Gold Member

    I searched Pubmed for 'ticklishness', two studies came out:

    and
    apparently it is the same receptors and all, it differs in how the brain interprets them.

    Think for instance of touch. You are wairing clothing, but you never feel distracted or drawn to the sensation of wearing cloth on your skin. But when someone touches your shoulder with the slightest touch, you feel and register it. It all happens in the brain.
     
  12. Jan 17, 2004 #11
    "It has been observed at least since the time of Aristotle that people cannot tickle themselves, but the reason remains elusive. "

    I can just picture aristotle lecturing;
    "Heavier things fall faster! Everything is made from earth, water, air and fire! The sun revolves around the earth! You cannot tickle yourself!"
     
Know someone interested in this topic? Share this thread via Reddit, Google+, Twitter, or Facebook

Have something to add?



Similar Discussions: Molecular Biology Q & A
  1. Molecular biology (Replies: 4)

  2. Molecular Biology Help (Replies: 2)

Loading...