View Full Version : Molecular Biology Q & A
Another God
Jan15-04, 06:49 AM
Post any questions you have about Molecular Biology in here (or anything related...Microbiology, lab techniques, experiments etc). Whether you want to know something specific (What is a nucleotide? for example), or something broad (What are RFLP's? for example). This thread could be useful to everyone whether you are a Molecular Biology student, or just someone who has read an article that refered to some terminology you didn't understand. Ask here and Monique, Ian, myself, or any one of the many other resident 'know it mosts' will try to answer it.
So, to start it off: I'm curious to find out more about PCR Primer design. Can anyone fill me in some more about Star Activity and annealing temperatures etc.
iansmith
Jan15-04, 10:03 AM
For primer design we use the follow guide line
18 to 25 nucleotides long. the longer the more specific it will be. I prefer 24 nt.
45-55% GC - I prefer 50% GC
Melting temperate around 60 Celcius - I usualy have 57 for 24 nt with 50% GC
Less than 4 nt of self complementary
no dimer formation @ 3' end
G or C @ 3' end - it give a more stringent binding
software for designing are not necessary I have designing my primer for about two years with any sofware and I have never had a primer not work in normal PCR and Sequencing from PCR produc and Plasmid. Direct Genomic sequencing is a bit more tricky.
the annealing temperature is calculate using the following formula Tm=4(G+C)+2(A+T). The higher the GC the higher the melting temperature. The melting temperature is when the DNA is seperate. You optimal anneling temperature will be 3-5 C lower than your melting temperature. The higher your anneling temperature, the more stringent it is.
Monique
Jan15-04, 01:13 PM
I do the same as Ian. Primers 20 nt long, both the same length (+- 1nt) GC closest to 50%, Tm close around 58oC, at will be 2-3 lower, Tm of both primers should be within 3 degree range.
A cool tool I always use is the Mac program Amplify, which is downloadable from the net. It's a cool tool since it does an in silico PCR and gives you the results of which fragments are going to be amplified and how strong. Very visual, very neat.
I check the primers GC and Tm in IDT oligoanalyzer http://biotools.idtdna.com/analyzer/.
Very easy. The picking of the primers I always do by eye, I always put them through Amplify though.. some parts of the genome are just incredibly GC rich and have Alu repeats.. and ofcourse those are the regions I need.. *sigh*
Monique
Jan15-04, 01:19 PM
Here is Amplify for the Mac
http://bip.weizmann.ac.il/mb/bioguide/pcr/PCRsofAmplify.html
If you are not going to use it, at least try it out :) you paste in the sequence which you want to look at, make it large! You paste in the primers you are planning on using, do PCR and out comes a graph of predicted products, their weight and how stabile the primers are on the sequence. It also warns in case of primer dimers.
Monique
Jan15-04, 01:23 PM
Originally posted by Another God
So, to start it off: I'm curious to find out more about PCR Primer design. Can anyone fill me in some more about Star Activity and annealing temperatures etc. AG, as far as I know star activity only takes place with restriction enzymes. When they are not kept at their optimal temperature, they'll start digesting DNA that isn't their recognition sequence.
More info:
New England Biolabs Technical Literature - Updated 09/23/2003
Star Activity
It has been demonstrated that under extreme non-standard conditions, restriction endonucleases are capable of cleaving sequences which are similar but not identical to their defined recognition sequence. This altered or relaxed specificity has been termed “star” activity. It has been suggested that star activity may be a general property of restriction endonucleases (1) and that any restriction endonuclease can be made to cleave noncanonical sites under certain extreme conditions. Testing at New England Biolabs has confirmed reports in the literature that the following restriction endonucleases can be made to exhibit star activity: Apo I (2), Ase I (2), BamH I (3), BssH II (2), EcoR I (4), EcoR V (5), Hind III (1), Hinf I (6,7), Pst I (8), Pvu II (9), Sal I (8), Sca I (2), Taq I (10), Xmn I (2).
The manner in which an enzyme's specificity is altered depends on the enzyme and on the conditions employed to induce the star activity. The most common types of altered activity are single base substitutions, truncation of the outer bases in the recognition sequence, and single-strand nicking (10). Early studies with EcoR I by Polisky et al. (4) demonstrated that under conditions of elevated pH and low ionic strength, EcoR I cleaves the sequence N/AATTN, while more recent studies by Gardner et al. (11) showed that EcoR I* (EcoR I star activity) cleaves any site which differs from the canonical recognition sequence by a single base substitution, providing the substitution does not result in an (A) to (T) or a (T) to (A) change in the central (AATT) tetranucleotide sequence.
SgrA I, which recognizes and cleaves the sequence CRCCGGYG, displays a new phenomenon of relaxation of sequence specificity. Under standard reaction conditions and in the presence of its cognate site, SgrA I is capable of cleaving non-cognate sites CRCCGGYN and CRCCGGGG (referred to as secondary sites). Studies performed with SgrA I reveal that DNA termini generated by cleaving the cognate site are an essential factor in the cleavage of secondary sites, as the secondary sites are not cleaved on DNA substrates that lack a cognate site (13).
Star activity is completely controllable in the vast majority of cases and is generally not a concern when performing restriction endonuclease digests. New England Biolabs’ enzymes will not exhibit star activity when used under recommended conditions in their supplied NEBuffers. Listed below are reaction conditions known to induce or inhibit star activity.
Conditions that Contribute to Star Activity
High glycerol concentration [>5% v/v]
High units to µg of DNA ratio [Varies with each enzyme, usually >100 units/µg]
Low ionic strength [<25 mM]
High pH [>pH 8.0]
Presence of organic solvents [DMSO, ethanol (9), ethylene glycol, dimethylacetamide, dimethylformamide, sulphalane (12)]
Substitution of Mg++ with other divalent cations [Mn++, Cu++, Co++, Zn++]
The relative significance of each of these altered conditions is dependent on the enzyme in question. For example, EcoR I is much more sensitive to elevated glycerol concentrations than is Pst I, which is more sensitive to elevated pH (2).
Inhibiting Star Activity
Recently, there has been much attention given to the fidelity of restriction endonucleases, particularly in forensic applications. If you are concerned about star activity, we recommend the following guidelines.
Use as few units as possible to get a complete digestion. This avoids overdigestion and reduces the final glycerol concentration in the reaction.
Make sure the reaction is free of any organic solvents such as alcohols which might be present in the DNA preparation.
Raise the ionic strength of the reaction buffer to 100-150 mM (provided the enzyme is not inhibited by high salt).
Lower the pH of the reaction buffer to pH 7.0.
Use Mg++ as the divalent cation.
References:
Nasri, M. and Thomas, D. (1986) Nucleic Acids Res. 14, 811.
New England Biolabs (unpublished observations)
George, J., Blakesley, R. W. and Chirikjian, J. G. (1980) J. Biol. Chem. 255, 6521.
Polisky, B. et al. (1975) Proc. Natl. Acad. Sci USA 72, 3310.
Kuz’min, N. P. et al. (1984) Mol. Biol (Moscow) 18, 197.
Petronzio, T. and Schildkraut, I. (1990) Nucl. Acids Res. 18, 3666.
Kriss, J. et al. (1990) Nucleic Acids Res. 18, 3665.
Malyguine, E., Vannier, P., Yot. (1980) Gene 8, 163.
Nasri, M. and Thomas, D. (1987) Nucleic Acids Res. 15, 7677.
Barany, F. (1988) Gene 65, 149.
Gardner, R. C., Howarth, A. J., Messing, J. and Shepherd, R. J. (1982) DNA 1, 109.
Tikchinenko, T. I. et al. (1978) Nucleic Acids Res. 4, 195.
Bitinaite, J. and Schildkraut, I. (2002) Proc. Natl. Acad. Sci USA 99, 1164-1169. http://www.neb.com/neb/frame_tech.html
iansmith
Jan15-04, 02:13 PM
Originally posted by Monique
I check the primers GC and Tm in IDT oligoanalyzer http://biotools.idtdna.com/analyzer/.
I use the oligocalculator
http://www.pitt.edu/~rsup/OligoCalc.html
Monique
Jan15-04, 02:37 PM
I think the IDT one is better, based on the following sequence:
GCATGGACTGACGGGGGCCCCAT
PITT says: 64 oC Tm
IDT says: 69.4 oC Tm
I think the IDT algorythm is more complicated and takes into account base to base interactions (several G's following eachother for instance are harder to melt).
Another God
Jan15-04, 04:09 PM
Thanks so much for all the info (particularly the Star Activity... I got confused and thought that that was related to Primers... Forgot it was Restriction enzyme effect!!!)
I think that question has been thoroughly covered now. Next! [:D]
I have a question. [:D]
Could you please explain to me the physiological basis of ticklishness? I am aware that there are free nerve endings in the skin, which respond to touch and are receptor-mediated, releasing neurotransmitters that go to the brain. I cannot find much more detail than this, though. Ticklishness is defined as a sensation separate from itch or pressure, and I am wondering how the body makes the distinction among the different types of touch. Are there individual touch receptors for each? Is it the same receptor but a different neurotransmitter that is released? If you could answer some of my questions or direct me in my research, it would be greatly appreciated.
Thank you,
Jeebus
Monique
Jan16-04, 08:53 AM
Originally posted by Jeebus
I have a question. [:D]
Could you please explain to me the physiological basis of ticklishness? I searched Pubmed for 'ticklishness', two studies came out:
Psychon Bull Rev. 1999 Sep; 6(3): 504-10. Related Articles, Links
Can a machine tickle?
Harris CR, Christenfeld N.
Department of Psychology-0109, University of California, San Diego, La Jolla, CA 92093-0109, USA. charris@psy.ucsd.edu
It has been observed at least since the time of Aristotle that people cannot tickle themselves, but the reason remains elusive. Two sorts of explanations have been suggested. The interpersonal explanation suggests that tickling is fundamentally interpersonal and thus requires another person as the source of the touch. The reflex explanation suggests that tickle simply requires an element of unpredictability or uncontrollability and is more like a reflex or some other stereotyped motor pattern. To test these explanations, we manipulated the perceived source of tickling. Thirty-five subjects were tickled twice--once by the experimenter, and once, they believed, by an automated machine. The reflex view predicts that our "tickle machine" should be as effective as a person in producing laughter, whereas the interpersonal view predicts significantly attenuated responses. Supporting the reflex view, subjects smiled, laughed, and wiggled just as often in response to the machine as to the experimenter. Self-reports of ticklishness were also virtually identical in the two conditions. Ticklish laughter evidently does not require that the stimulation be attributed to another person, as interpersonal accounts imply. and
Biol Psychol. 1990 Apr; 30(2): 141-50. Related Articles, Links
Relations between tickling and humorous laughter: preliminary support for the Darwin-Hecker hypothesis.
Fridlund AJ, Loftis JM.
Department of Psychology, University of California, Santa Barbara 93106.
Following hypotheses by Darwin and Hecker on the connection between tickling and humorous laughter, questionnaire data were collected from 100 college students regarding their reported ticklishness and tendencies to laugh and show responses ancillary to laughter. Ticklishness was related to propensities to: (a) giggle, (b) laugh, (c) smile, (d) piloerect, (e) blush, and (f) cry. These findings lend preliminary support for the Darwin-Hecker conjecture that reflexes underlying ticklishness mediate humor. We speculate on possible relations among tickling and humor, and reasons why people laugh and smile when they find things funny.[:D] apparently it is the same receptors and all, it differs in how the brain interprets them.
Think for instance of touch. You are wairing clothing, but you never feel distracted or drawn to the sensation of wearing cloth on your skin. But when someone touches your shoulder with the slightest touch, you feel and register it. It all happens in the brain.
wasteofo2
Jan17-04, 05:40 AM
"It has been observed at least since the time of Aristotle that people cannot tickle themselves, but the reason remains elusive. "
I can just picture aristotle lecturing;
"Heavier things fall faster! Everything is made from earth, water, air and fire! The sun revolves around the earth! You cannot tickle yourself!"
vBulletin® v3.8.7, Copyright ©2000-2012, vBulletin Solutions, Inc.