PDA

View Full Version : DNA Replication Correction


STAii
Sep29-03, 02:17 PM
Greetings.
I just have a small question about DNA replication correction.
My textbook states (might contain errors of translation):

1)DNA replication errors include :
--A)Adding nucleotides (more that is supposed to).
--B)Removing nucleotides (from places they are supposed to be in).
--C)Putting nucleotides in wrong places.
2)There are several enzymes that work to correct replication errors, some of them do the following :
--A)Locate the place of the error on the DNA, and cut it out.
--B)Build new nucleotide pairs to come in the place of the cut part
--C)Attach new nucleotides to the DNA in the place of cut

Now my question is about locating the place of the DNA error. Locating the place of a wrong nucleotide might seem logical, but how can the enzyme locate the place of a missing nucleotide ?
Thanks in advance.

iansmith
Sep29-03, 03:25 PM
The error you mentiton usually leaves a "physicals" deformation on the DNA strand. For example, mismatch of an nucleic acid does a king of a bump on the DNA strand. The enzyme involve in post-replication repair will more or less recognize those deformation. DNA polymerase also can regognize those mistake as it add up the NTP's. It has 3'-5' exonuclease activity to move backward. The trick is not to recognize the mistake but to recognize which strand is the mother and the daughter. That is were DNA methylation that care of this. The problem is when the mistake is not corrected before methylation.

STAii
Sep30-03, 07:24 AM
Originally posted by iansmith
DNA polymerase also can regognize those mistake as it add up the NTP's. It has 3'-5' exonuclease activity to move backward. The trick is not to recognize the mistake but to recognize which strand is the mother and the daughter. That is were DNA methylation that care of this. The problem is when the mistake is not corrected before methylation.
Can you please explain the quoted part above, excuse my language but i am unable to understand the bolded words.
Thanks.

iansmith
Sep30-03, 10:03 AM
NTP's are is a term for ATP, GTP, CTP, and TTP or UTP (which shorter than listing them) which are add to the DNA to become A, G, C, and T or u.

exonuclease: enzyme that cuts DNA from 5' or 3' ends (outside to inside).

methylation: Addition of a methyl group on a target site. It usually on C's.

STAii
Sep30-03, 10:57 AM
What do you mean by "cuts DNA from 5' or 3' ends" ?
What did you mean by "The trick is not to recognize the mistake but to recognize which strand is the mother and the daughter" ? How is that trick exactly ?
Can you explain a little bit about how methylation is related to DNA replication, cause i have no idea about that !

Thanks a million.

iansmith
Sep30-03, 01:03 PM
Originally posted by STAii
What do you mean by "cuts DNA from 5' or 3' ends" ?


Here a graphical explanation
Here a random sequence

5' PO4-ACTGACTGACTGAGGATCAGC-OH 3'

the exonuclease (EN) will come and cleave DNA from the 5' end

1 cut :
5' A EN PO4-CTGACTGACTGAGGATCAGC-OH 3'

2nd cut
5' C EN PO4-TGACTGACTGAGGATCAGC-OH 3'

and so on

Originally posted by STAii

What did you mean by "The trick is not to recognize the mistake but to recognize which strand is the mother and the daughter" ? How is that trick exactly ?

This tricky because the mother strand has the rigth sequence whereas the daughter strand has the misplace nucleotide. If the enzyme does not recognize the proper strand than it will correct the error by another error. Therefore there is a mutation.

For example

Mother ____ACTGTGCGTACGTACCTGATGC

Daughter___TGACACGCATCAATGGACTACG

Let assume there is no methylation and no way for the enzyme to deferienciate mother and daughter. So the enzyme come along discover the mistake and fix it as following

Mother____ACTGTGCGTACTTACCTGATGC

Daughter __TGACACGCATCAATGGACTACG

So we got a mutation. If it is only one in 100 million of base pair it is ok but if its one in 100 thousand then we have a problem

Originally posted by STAii

Can you explain a little bit about how methylation is related to DNA replication, cause i have no idea about that !

There an enzyme call methylazed that will add a methyl group to the nucleic acid so after the replication of the DNA.
______________CH3
________________|
5' AGATGATGATGATCAGTGACT 3'

The methyl group are added to a certain typical sequence depending on the species. These sequence tend to be present at a high level through out the genome. Methyl has 2 purpose. 1st it there to protect the DNA from restriction endonuclease and the 2nd is to differentiate between the old strand for the newly replicate strand.

When repair enzyme are looking for mistake they will find the methylation group and use the methylated strand as the template to fix the mistake.