Is a raw DNA sequence meaningless on its own?

[DavidSnider]

Let's say an extraterrestrial space probe crashes into Earth and we recover from it a disk that we conclude contains a genome.

Would we be able to tell anything about them from that information alone?

What kind of experiments would you run on it?

 

[mishrashubham]

Let's say an extraterrestrial space probe crashes into Earth and we recover from it a disk that we conclude contains a genome.

Would we be able to tell anything about them from that information alone?

What kind of experiments would you run on it?

It is not all so simple.

Firstly it is very unlikely that living organisms somewhere on a distant planet use exactly the same nucleic acids for their genetic material. However it is also equally unlikely that aliens use magnetic information storage devices and that we will have the technology to extract any information. Even if we recover something that can be considered information, how do we decode it? We use the binary system for most of our digital information storage. Who knows what standards aliens follow?

Even after assuming all the above is true, any information we obtain will be virtually meaningless to us. More important is the knowledge that can be derived by reverse engineering the remains of the space probe.

 

[DavidSnider]

It is not all so simple.
Firstly it is very unlikely that living organisms somewhere on a distant planet use exactly the same nucleic acids for their genetic material.

Why is that unlikely? I would think that if life did arise on another planet it was probably a planet similar to ours. 'Unlikely' is hard to quantify in such a large universe, but that's another discussion.

However it is also equally unlikely that aliens use magnetic information storage devices and that we will have the technology to extract any information. Even if we recover something that can be considered information, how do we decode it? We use the binary system for most of our digital information storage. Who knows what standards aliens follow?

It could simply be a quaternary code etched on a metal disk nothing fancy..

Even after assuming all the above is true, any information we obtain will be virtually meaningless to us. More important is the knowledge that can be derived by reverse engineering the remains of the space probe.

Why would it be useless? That's pretty much the point of this thought experiment. Remember we are assuming we know it to be a genetic code somewhat similar in structure to our own.

 

[mishrashubham]

Why is that unlikely? I would think that if life did arise on another planet it was probably a planet similar to ours. 'Unlikely' is hard to quantify in such a large universe, but that's another discussion.

The fact Earth's living organisms use DNA as genetic material, is simply a matter of chance. It could well have been some other macromolecule.

It could simply be a quaternary code etched on a metal disk nothing fancy..

Or it could also be hexadecimal, octal, decimal and what not. It could be a metal disk, optical disk, flash cube, nanodisk, anything. That is my point; we don't know which system they follow, nor can we surely expect to have the necessary technology to read the information.

Why would it be useless? That's pretty much the point of this thought experiment. Remember we are assuming we know it to be a genetic code somewhat similar in structure to our own.

There is a difference between "meaningless" and "useless". Any code is meaningless unless we find out the means to decode it.

 

[mishrashubham]

However leaving aside the details of the situation, if we do find parts of the genome of an organism living on earth, we can recover some useful information by comparing it with the databases we already have.

 

[DavidSnider]

Yeah I know that, that's why I chose extraterrestrial life for the thought experiment, I wanted to exclude all life that was involved in our evolution.

I could have phrased it like: Say life evolved independently twice on this planet and all we have left of the previous instance is some genetic code (forget how we got it) but no living organisms to toy with or compare it to other than our own.

 

[mishrashubham]

Yeah I know that, that's why I chose extraterrestrial life for the thought experiment, I wanted to exclude all life that was involved in our evolution.

I could have phrased it like: Say life evolved independently twice on this planet and all we have left of the previous instance is some genetic code (forget how we got it) but no living organisms to toy with or compare it to other than our own.

In that case I have already given my answer. No useful information can be extracted.

 

[Ryan_m_b]

I agree with mish here, you would not be able to get any useful information. Assuming that you did have DNA (leaving aside the various other options) on it's own it would not tell you anything. You wouldn't know what parts were http://en.wikipedia.org/wiki/Promoter_(biology)" and that's all assuming that these things are also part of this extraterrestrial's biochemistry.

In reality you would need a live sample so that you could map the biochemical equivalents of the http://en.wikipedia.org/wiki/Genome" . So far we have only accomplished genome sequencing for a handful of organisms on Earth let alone developing tools that work on alien biochemistry's.

 

[That Neuron]

Honestly... we all run on the same chemical "code" so it really depends upon how long the genome is, if it contains the equivalent of 4 nucleotides... then it would be hard to distinguish as a genome... let alone what each nucleotide corresponds to. However, if you have a genome of 10^8 nucleotides, we get a step closer to understanding how their genome works. So let's say that every life-form (with a genome) works in a similar way to us, i.e. that it transcribes the composition of other 'worker' molecules (possibly making an unwarranted generalization here). Then we could theorize what the most logical 'worker' molecule (enzyme) is created by the alien sequence, if we could do this (it would take years of research) we would still have a problem... complex multicellular organisms don't just follow their genome and create themselves from a single genome, they are guided by their environment. Look at a baby developing in the uterus... It is affected greatly by the original conditions of the sperm and egg cells, by histone molecules surrounding its genome, regulating gene expression... so forth. Without all this non-genetic information you could not produce a human... you might have tissues somewhat human-like but probably closer to a fish than a human.

 

[Ryan_m_b]

So let's say that every life-form (with a genome) works in a similar way to us, i.e. that it transcribes the composition of other 'worker' molecules (possibly making an unwarranted generalization here). Then we could theorize what the most logical 'worker' molecule (enzyme) is created by the alien sequence, if we could do this (it would take years of research)

I'm not sure how you come to this conclusion, assuming that the extraterrestrial sequence used DNA and the same 4 base pairs as us we still wouldn't know what codes for what. For example, if I gave you this sequence

ACCACTTGACATCGATTACGACTAGGGCTAGCATCGAGCTACGGGGATCAGCTACGAGCTAGCGCTAGCAT

You wouldn't get any information out of it because you don't know what was http://en.wikipedia.org/wiki/Intron" . And this is all making the huge assumption that this DNA is ordered and utilised in the exact same way as life on Earth.

However I do agree with your conclusion here;

complex multicellular organisms don't just follow their genome and create themselves from a single genome, they are guided by their environment. Look at a baby developing in the uterus... It is affected greatly by the original conditions of the sperm and egg cells, by histone molecules surrounding its genome, regulating gene expression... so forth. Without all this non-genetic information you could not produce a human... you might have tissues somewhat human-like but probably closer to a fish than a human.

Too often people assume that genes are orders that are faithfully carried out rather than sub-components of molecules responsible for highly contextual biochemical reactions.

 

[That Neuron]

I'm not sure how you come to this conclusion, assuming that the extraterrestrial sequence used DNA and the same 4 base pairs as us we still wouldn't know what codes for what. For example, if I gave you this sequence

ACCACTTGACATCGATTACGACTAGGGCTAGCATCGAGCTACGGGGATCAGCTACGAGCTAGCGCTAGCAT

You wouldn't get any information out of it because you don't know what was http://en.wikipedia.org/wiki/Intron" . And this is all making the huge assumption that this DNA is ordered and utilised in the exact same way as life on Earth.

It relies on the individual codons and what they stand for, true... I hadnt thought of that, so I agree with you, I was thinking that you could decifer this by examining the structure of the tRNA molecule, but you would need to know the code of what nucleotides match with what codons before you could decifer that, so I've caught myself in a paradox there.

 

[Ryan_m_b]

It relies on the individual codons and what they stand for, true... I hadnt thought of that, so I agree with you, I was thinking that you could decifer this by examining the structure of the tRNA molecule, but you would need to know the code of what nucleotides match with what codons before you could decifer that, so I've caught myself in a paradox there.

It is a circular problem; to know the code you have to know the reader, which is buried somewhere in the code

 

[That Neuron]

lol Circular logic works because Circular logic works because circular logic works...