Dismiss Notice
Join Physics Forums Today!
The friendliest, high quality science and math community on the planet! Everyone who loves science is here!

Is a raw DNA sequence meaningless on its own?

Tags:
  1. Jul 16, 2011 #1

    DavidSnider

    User Avatar
    Gold Member

    Let's say an extraterrestrial space probe crashes into earth and we recover from it a disk that we conclude contains a genome.

    Would we be able to tell anything about them from that information alone?

    What kind of experiments would you run on it?
     
  2. jcsd
  3. Jul 16, 2011 #2
    It is not all so simple.

    Firstly it is very unlikely that living organisms somewhere on a distant planet use exactly the same nucleic acids for their genetic material. However it is also equally unlikely that aliens use magnetic information storage devices and that we will have the technology to extract any information. Even if we recover something that can be considered information, how do we decode it? We use the binary system for most of our digital information storage. Who knows what standards aliens follow?

    Even after assuming all the above is true, any information we obtain will be virtually meaningless to us. More important is the knowledge that can be derived by reverse engineering the remains of the space probe.
     
  4. Jul 16, 2011 #3

    DavidSnider

    User Avatar
    Gold Member

    Why is that unlikely? I would think that if life did arise on another planet it was probably a planet similar to ours. 'Unlikely' is hard to quantify in such a large universe, but that's another discussion.

    It could simply be a quaternary code etched on a metal disk nothing fancy..

    Why would it be useless? That's pretty much the point of this thought experiment. Remember we are assuming we know it to be a genetic code somewhat similar in structure to our own.
     
  5. Jul 16, 2011 #4
    The fact earth's living organisms use DNA as genetic material, is simply a matter of chance. It could well have been some other macromolecule.


    Or it could also be hexadecimal, octal, decimal and what not. It could be a metal disk, optical disk, flash cube, nanodisk, anything. That is my point; we don't know which system they follow, nor can we surely expect to have the necessary technology to read the information.


    There is a difference between "meaningless" and "useless". Any code is meaningless unless we find out the means to decode it.
     
  6. Jul 16, 2011 #5
    However leaving aside the details of the situation, if we do find parts of the genome of an organism living on earth, we can recover some useful information by comparing it with the databases we already have.
     
  7. Jul 16, 2011 #6

    DavidSnider

    User Avatar
    Gold Member

    Yeah I know that, that's why I chose extraterrestrial life for the thought experiment, I wanted to exclude all life that was involved in our evolution.

    I could have phrased it like: Say life evolved independently twice on this planet and all we have left of the previous instance is some genetic code (forget how we got it) but no living organisms to toy with or compare it to other than our own.
     
  8. Jul 16, 2011 #7
    In that case I have already given my answer. No useful information can be extracted.
     
  9. Jul 16, 2011 #8

    Ryan_m_b

    User Avatar

    Staff: Mentor

    I agree with mish here, you would not be able to get any useful information. Assuming that you did have DNA (leaving aside the various other options) on it's own it would not tell you anything. You wouldn't know what parts were http://en.wikipedia.org/wiki/Promoter_(biology)" [Broken] and that's all assuming that these things are also part of this extraterrestrial's biochemistry.

    In reality you would need a live sample so that you could map the biochemical equivalents of the http://en.wikipedia.org/wiki/Genome" [Broken]. So far we have only accomplished genome sequencing for a handful of organisms on Earth let alone developing tools that work on alien biochemistry's.
     
    Last edited by a moderator: May 5, 2017
  10. Jul 21, 2011 #9
    Honestly... we all run on the same chemical "code" so it really depends upon how long the genome is, if it contains the equivalent of 4 nucleotides... then it would be hard to distinguish as a genome... let alone what each nucleotide corresponds to. However, if you have a genome of 10^8 nucleotides, we get a step closer to understanding how their genome works. So lets say that every life-form (with a genome) works in a similar way to us, i.e. that it transcribes the composition of other 'worker' molecules (possibly making an unwarranted generalization here). Then we could theorize what the most logical 'worker' molecule (enzyme) is created by the alien sequence, if we could do this (it would take years of research) we would still have a problem... complex multicellular organisms don't just follow their genome and create themselves from a single genome, they are guided by their environment. Look at a baby developing in the uterus... It is affected greatly by the original conditions of the sperm and egg cells, by histone molecules surrounding its genome, regulating gene expression... so forth. Without all this non-genetic information you could not produce a human... you might have tissues somewhat human-like but probably closer to a fish than a human.
     
  11. Jul 21, 2011 #10

    Ryan_m_b

    User Avatar

    Staff: Mentor

    I'm not sure how you come to this conclusion, assuming that the extraterrestrial sequence used DNA and the same 4 base pairs as us we still wouldn't know what codes for what. For example, if I gave you this sequence

    ACCACTTGACATCGATTACGACTAGGGCTAGCATCGAGCTACGGGGATCAGCTACGAGCTAGCGCTAGCAT


    You wouldn't get any information out of it because you don't know what was http://en.wikipedia.org/wiki/Intron" [Broken]. And this is all making the huge assumption that this DNA is ordered and utilised in the exact same way as life on Earth.

    However I do agree with your conclusion here;

    Too often people assume that genes are orders that are faithfully carried out rather than sub-components of molecules responsible for highly contextual biochemical reactions.
     
    Last edited by a moderator: May 5, 2017
  12. Jul 21, 2011 #11
    It relies on the individual codons and what they stand for, true... I hadnt thought of that, so I agree with you, I was thinking that you could decifer this by examining the structure of the tRNA molecule, but you would need to know the code of what nucleotides match with what codons before you could decifer that, so ive caught myself in a paradox there.
     
    Last edited by a moderator: May 5, 2017
  13. Jul 21, 2011 #12

    Ryan_m_b

    User Avatar

    Staff: Mentor

    It is a circular problem; to know the code you have to know the reader, which is buried somewhere in the code :tongue2:
     
  14. Jul 21, 2011 #13
    lol Circular logic works because Circular logic works because circular logic works...
     
Know someone interested in this topic? Share this thread via Reddit, Google+, Twitter, or Facebook




Similar Discussions: Is a raw DNA sequence meaningless on its own?
  1. DNA Sequencing (Replies: 7)

Loading...