1. Limited time only! Sign up for a free 30min personal tutor trial with Chegg Tutors
    Dismiss Notice
Dismiss Notice
Join Physics Forums Today!
The friendliest, high quality science and math community on the planet! Everyone who loves science is here!

Homework Help: Genetics: Understanding the Base Sequence of Messenger RNA

  1. Jun 14, 2018 #1
    1. The problem statement, all variables and given/known data


    I am reviewing an example on the basics of the genetic code; this example is listed at the bottom of the following webpage: https://www.atdbio.com/content/14/Transcription-Translation-and-Replication.


    I have produced the example below and added Roman numbers to better indicate the parts that I am questioning (V and VII).



    2. Relevant equations

    Not applicable

    (Well, I suppose Chargaff's rules apply for DNA.)

    3. The attempt at a solution



    I understand that Strand A (5' -> 3') is this:


    5′-TCGTCGACGATGATCATCGGCTACTCGA-3'.


    However, if the above is (or designated) the coding strand, then why is the mRNA sequence (following transcription) not this (see below)?


    5'-UCGUCGACGAUGAUCAUCGGCUACUCGA-3' (Thought One)


    I thought that the defining trait of the DNA coding strand is that its base sequence is almost the same as the resulting mRNA sequence, with the exception that uracil (U) substitutes for thymine (T).


    I have the same question for Strand B (see IV):

    5'-TCGAGTAGCCGATGATCATCGTCGACGA-3'.


    Why is the mRNA sequence of Strand B, if it is coding, not:

    5'-UCGAGUAGCCGAUGAUCAUCGUCGACGA-3' (Thought 2)?


    (Although Strand B is the template strand in III, it clearly states later to assume that it is coding.)



    As you may notice, my Thoughts 1 and 2 (for Strands A and B, respectively) are the switched answers for V and VII. That is, what I thought was the correct mRNA sequence corresponding to Strand A (see Thought 1) is actually the listed sequence that corresponds to Strand B (see VII).


    I really appreciate your help on where I went wrong.


    Thanks again.
     
    Last edited: Jun 14, 2018
  2. jcsd
  3. Jun 14, 2018 #2

    Ygggdrasil

    User Avatar
    Science Advisor
    2017 Award

    There are two ways of naming the two strands of a gene that is being transcribed. The first is from the perspective of the RNA polymerase enzyme that is synthesizing the RNA. RNA polymerase moves from the 3' to 5' of the template strand, producing an mRNA that is complementary to the template. The other strand of DNA that the polymerase does not read is called the non-template strand. Because the non-template strand is also complementary to the template strand, the mRNA ends up having the same sequence as the non-template strand (except that T is replaced with U). Therefore, we often refer to the non-template strand as the coding strand (or the sense strand). The template strand is therefore the non-coding strand or anti-sense strand.

    So, in your example, if V is the mRNA, then I is the coding strand/non-template strand and III is the template strand/non-coding strand. sequence II is the template strand/non-coding strand and sequence III is the coding strand/non-template strand.
     
    Last edited: Jun 14, 2018
  4. Jun 14, 2018 #3
    Dear Ygggdrasil,

    If you look at the coding, or non-template, strand 5’-TCGTCGACGATGATCATCGGCTACTCGA-3’, how is this the same sequence as the mRNA strand in V (with exception of substituting T with U), 5’-UCGAGUAGCCGAUGAUCAUCGUCGACGA-3’?


    Thank you for any clarification.
     
  5. Jun 14, 2018 #4

    Ygggdrasil

    User Avatar
    Science Advisor
    2017 Award

    Given the template strand is 3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5'

    If RNA polymerase uses the template strand as a template to synthesize mRNA, the mRNA will be the reverse complement of the template strand.

    For the coding DNA strand to pair with the template DNA strand, the coding stand must also be the reverse complement of the template strand.
     
  6. Jun 14, 2018 #5
    If I use 3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5' as the template strand and rules T = A and A = U,

    then would not the mRNA strand be:
    --------5'-UCGUCGACGAUGAUCAUCGGCUACUCGA-3'? [1]

    From V. in the example, the above [1] does not match:
    --------5’-UCGAGUAGCCGAUGAUCAUCGUCGACGA-3’.

    I apologize for all these questions. Please let me know what I am doing incorrectly.

    Thanks again.
     
  7. Jun 14, 2018 #6

    Ygggdrasil

    User Avatar
    Science Advisor
    2017 Award

    I previously did not look closely at the exact sequences, so I have corrected my post #2.

    Based on a template strand of 3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5' (sequence III), sequence [1] (5'-UCGUCGACGAUGAUCAUCGGCUACUCGA-3') is indeed the correct sequence of the mRNA.

    Sequence V (UCGAGUAGCCGAUGAUCAUCGUCGACGA) is the mRNA one would get when sequence II serves as the template strand.
     
  8. Jun 15, 2018 #7
    Therefore, as indicated from my first post, mRNA sequence VII,
    5'-UCGUCGACGAUGAUCAUCGGCUACUCGA-3',
    results when sequence III
    3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5'
    is the template strand and sequence II (Strand A) is the coding, or non-template, strand

    (5′-TCGTCGACGATGATCATCGGCTACTCGA-3').

    Is this correct?

    Thank you for your help.
     
  9. Jun 15, 2018 #8

    Ygggdrasil

    User Avatar
    Science Advisor
    2017 Award

    Yes that is correct. As you indicated, the quoted information in part 1 of post #1 seems to confuse the terms for coding strand and template strand.
     
Share this great discussion with others via Reddit, Google+, Twitter, or Facebook

Have something to add?
Draft saved Draft deleted