1. Not finding help here? Sign up for a free 30min tutor trial with Chegg Tutors
    Dismiss Notice
Dismiss Notice
Join Physics Forums Today!
The friendliest, high quality science and math community on the planet! Everyone who loves science is here!

Point mutation, change in rna and protein

  1. Nov 7, 2015 #1
    1. The problem statement, all variables and given/known data

    UV Rays is said to induce point mutations which get incorporated during the DNA replication process. These mutations are corrected by the excision repair mechanism of the DNA polymerase but sometimes they might be left out. In one of such cases, point insertions were incorporated. The DNA sequence is given as under
    5'GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAG 3’
    i) The nucleotide “T “is inserted after the “G” which has been bolded. Will the mRNA and the protein sequence change?
    ii) The nucleotide “T” is inserted after the bolded “T”. What are the changes in mRNA and the protein?
    2.
    2. Relevant equations
    Can't think for this question which is applicable.

    3. The attempt at a solution
    It is looking to me a frameshift mutation in both cases, so there will be completely different mRNA and proteins form. But I do not know properly that what I am thinking is correct or not.
     
  2. jcsd
  3. Nov 8, 2015 #2

    Ygggdrasil

    User Avatar
    Science Advisor

    Can you say what the changed protein sequence will be in each case?
     
  4. Nov 9, 2015 #3
    The original protein sequence is:
    Valine- Serine- Valine- Stop-......................etc.
    But, we should not go further since the stop codon UAA comes.
    Here in question 5'......3' dna strand is non-template strand and mRNA sequence would be that of strand by substituting U in place of T.
    Mutation is anyway taking place after that codon, so it does not matter.
    So these answer my both questions that is no change in protein sequence?
    So to this question, only this much answer?
     
  5. Nov 9, 2015 #4

    Ygggdrasil

    User Avatar
    Science Advisor

    It depends which part of the sequence is considered the coding sequence. For example, there is a start codon further down. Is that AUG the start of the coding sequence or is the stop codon at the beginning the end of the coding sequence? It's unclear from the information you've given.
     
  6. Nov 9, 2015 #5
    So how do I answer this question?
    It was given to us as an assignment and I am having confusion.
     
  7. Nov 9, 2015 #6

    Ygggdrasil

    User Avatar
    Science Advisor

    Ask your instructor for clarification.
     
  8. Nov 9, 2015 #7
    If this question comes in test, having probability of coming 1/5, is my logic of answering correct? I don't have a class with my instructor till the test takes place.
    Or should I mail him this question, though don't know if someone answers in a mail subject questions and it is not good to ask in a mail.
     
Know someone interested in this topic? Share this thread via Reddit, Google+, Twitter, or Facebook

Have something to add?
Draft saved Draft deleted



Similar Discussions: Point mutation, change in rna and protein
  1. RNA polymerase (Replies: 1)

  2. Gene mutation (Replies: 1)

Loading...