Point mutation, change in rna and protein

Join the discussion
Registration is free. Ask a follow-up in this thread, or start your own.
6 replies · 2K views
Raghav Gupta
Messages
1,010
Reaction score
76

Homework Statement



UV Rays is said to induce point mutations which get incorporated during the DNA replication process. These mutations are corrected by the excision repair mechanism of the DNA polymerase but sometimes they might be left out. In one of such cases, point insertions were incorporated. The DNA sequence is given as under
5'GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAG 3’
i) The nucleotide “T “is inserted after the “G” which has been bolded. Will the mRNA and the protein sequence change?
ii) The nucleotide “T” is inserted after the bolded “T”. What are the changes in mRNA and the protein?
2.

Homework Equations


Can't think for this question which is applicable.

The Attempt at a Solution


It is looking to me a frameshift mutation in both cases, so there will be completely different mRNA and proteins form. But I do not know properly that what I am thinking is correct or not.
 
Physics news on Phys.org
Ygggdrasil said:
Can you say what the changed protein sequence will be in each case?
The original protein sequence is:
Valine- Serine- Valine- Stop-......etc.
But, we should not go further since the stop codon UAA comes.
Here in question 5'...3' dna strand is non-template strand and mRNA sequence would be that of strand by substituting U in place of T.
Mutation is anyway taking place after that codon, so it does not matter.
So these answer my both questions that is no change in protein sequence?
So to this question, only this much answer?
 
It depends which part of the sequence is considered the coding sequence. For example, there is a start codon further down. Is that AUG the start of the coding sequence or is the stop codon at the beginning the end of the coding sequence? It's unclear from the information you've given.
 
So how do I answer this question?
It was given to us as an assignment and I am having confusion.
 
If this question comes in test, having probability of coming 1/5, is my logic of answering correct? I don't have a class with my instructor till the test takes place.
Or should I mail him this question, though don't know if someone answers in a mail subject questions and it is not good to ask in a mail.