- #1
Raghav Gupta
- 1,011
- 76
Homework Statement
UV Rays is said to induce point mutations which get incorporated during the DNA replication process. These mutations are corrected by the excision repair mechanism of the DNA polymerase but sometimes they might be left out. In one of such cases, point insertions were incorporated. The DNA sequence is given as under
5'GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAG 3’
i) The nucleotide “T “is inserted after the “G” which has been bolded. Will the mRNA and the protein sequence change?
ii) The nucleotide “T” is inserted after the bolded “T”. What are the changes in mRNA and the protein?
2.
Homework Equations
Can't think for this question which is applicable.
The Attempt at a Solution
It is looking to me a frameshift mutation in both cases, so there will be completely different mRNA and proteins form. But I do not know properly that what I am thinking is correct or not.