How do overlapping reading frames happen?

Join the discussion
Ask a follow-up here, or get your own question answered by working scientists, mathematicians and engineers — people, not an autocomplete.
Real named experts · corrections over time · the nuance an AI answer skips
6 replies · 7K views
Brainguy
Messages
43
Reaction score
0
Overlapping reading frames in influenza viruses allow two proteins to be coded into the same RNA segment, but only by what appears to me as an enormous coincidence. the analogy I came up with is that overlapping reading frames are like taking a book, and moving every space one character to the right while expecting a different story to emerge. Dog bites man would become dogb itesm an. I feel like I'm missing something here, since neither dogb nor itesm are words.
 
Biology news on Phys.org
Hi Brainguy,
Doesn't figure 3 give you the information you are after?
I know them as alternative reading frames. A cool example I found is the hepadnavirus.
The alternative reading frame works because shifting to a different reading frame produces a new alignment of codons, coding for a different sequence of amino acids.
e.g. Take the mRNA sequence AUGUUUUCAUGUCAUGGGUGACAUGAC (the start codons are in bold or underlined).

Using the first start codon (in bold) and reading three nucleotides for each codon gives AUG UUU UCA UGU CAU GGG UGA, which translates to Met(start) Phe Ser Cys His Gly stop.
Using the second start codon (underlined) and reading three nucleotides for each codon gives AUG UCA UGG GUG ACA UGA, which translates to Met(start) Ser Trp Val Thr stop.
The start codon identifies the frame for reading the triplets. Because the start codons are not in frame (i.e. AUG CCC AUG), they 'set the reading frame of the sequence differently. The two reading frames give different triplet sequences and therefore map to different amino acids (and stop codons). The comparison to words is not quite accurate, since all possible permutations of the four nucleotides maps to an amino acid or stop codon.

I think that makes sense, some more knowledgeable can check and correct.
Otherwise, I hope that helps.
 
It is indeed amazing that some viruses can encode two different proteins that overlap in their coding sequences. Part of the reason this is possible is that the genetic code is redundant – most amino acids can be encoded by a number of different codons. This redundancy provides evolution with the flexibility to accommodate two different protein sequences on the same DNA sequence.
 
Alright, so I am not missing any information? This is truly as amazing as I thought it was? this is a powerful illustration of the power of evolution. The amount of work required to write a book using the example I provided would be tremendous and in many cases impossible, but Mother Nature does it trillions of times every day inside the nuclei of infected cells.
 
Hi,

I disagree with the point that redundancy in the genetic code leads to more diversity. If different codon strings map to the same amino-acid, the tendency will be towards uniformity of the amino-acid sequence, despite differences (or mutations even) in the nucleotide sequence.

So if I was a virus (maybe I am :-) ) and I wanted to exploit the same nucleotide sequence for a different protein, many of my attempts would be synonymous, i.e. I'd often get the same protein, despite my efforts. Clearly, shifting my reading frame would be a more effective step to take.