Morpholino antisense drug approval (US FDA): eteplirsen

  • Thread starter Thread starter JonMoulton
  • Start date Start date
  • Tags Tags
    rna
Join the discussion
Registration is free. Start your own thread to ask a follow-up.
2 replies · 3K views
JonMoulton
Messages
49
Reaction score
7
A Morpholino antisense drug has been approved by the US FDA.

http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm521263.htm

This drug binds to complementary RNA to change biology, in this case altering the splicing of the protein that, when mutated, can cause Duchenne muscular dystrophy (DMD). Frameshift mutations cause DMD; antisense oligo can often restore the downstream reading frame by causing the spliceosome to excise exons which put the reading frame back in-phase.

This is background on Morpholinos.

https://en.wikipedia.org/wiki/Morpholino

Here are some notes about the drug.

Eteplirsen (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488)

Morpholino phosphorodiamidate antisense oligomer

CTCCAACATCAAGGAAGATGGCATTTCTAG
20-mer
20% G
43% CG
Predicted Tm: 88.9°C at 10 µM oligo.

Oligo complement
CTAGAAATGCCATCTTCCTTGATGTTGGAG

DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation.
CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT
CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC
GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA
GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
 
Biology news on Phys.org
Unfortunately, the case of eteplirsen is the case of a drug company (Sarepta) exploiting patient advocacy groups to push their drug through FDA approval without good studies on the efficacy of the drug.

Although the science behind morpholinos and the exon-skipping strategy is sound, it has been notoriously difficult to deliver RNA therapeutics effectively in the clinic. Although clinical trial showed that the drug increases in the amount of dystrophin protein, the increase was very small and many experts (including those at the FDA) question whether those increases would be clinically significant. Furthermore, the trial was based on only 12 patients and the trial was run so badly that according to the FDA's summary of it's decision to approve eteplirsen, "Major flaws in both the design and conduct of the clinical trials using eteplirsen have made it impossible to use much of the resulting trial data as reliable evidence in regulatory decision-making, including for reasonable extrapolation to clinical care." The FDA commissioner has even characterized published studies on the efficacy of eteplirsen as misleading and has called for the studies to be retracted.

While the FDA review team concluded that eteplirsen was not likely to be effective against DMD, they were overruled by their director, Janet Woodcock. Officials inside the FDA have complained that Woodcock was inappropriately interfering with the scientific review of the drug as she faced pressure from patient advocacy groups.
“Rather than ensuring that the scientific reviews started at the bottom of the chain of command, Dr. Woodcock made clear from her position at the top that she was pushing for a particular outcome from the very early stages,” [Dr. Luciana Borio, FDA acting chief scientist] wrote. And she noted that at least two staffers were leaving or were about to leave in response to the decision-making process “and the pressures exerted by outside forces.”
https://www.statnews.com/pharmalot/2016/09/19/sarepta-fda-duchenne-behind-the-decision/

Many have noted that this sets a worrysome precedent. Drug industry blogger Derek Lowe writes:
I think that Sarepta should have run a better trial, and should have gathered more data when the FDA told them that more information was needed. Instead, the company stood pat, called up Duchenne-affected boys and their families to plead with the FDA, and won over Janet Woodcock, and that appears to be enough. Is this going to be the new way to get a drug approved? Run a trial in a dozen people, generate unconvincing data, and then lobby Janet Woodcock? I share the worries that this might open the floodgates, because after all, Sarepta got their drug through.
http://blogs.sciencemag.org/pipeline/archives/2016/09/20/sarepta-gets-an-approval-unfortunately

Of course, given how rare the disease is (eteplirsen is predicted to be effective against only a subset of DMD patients containing a specific mutation), it is difficult and expensive to conduct large clinical trials, but that does not excuse how Sarepta has mishandled the conduct and analysis of their clinical trials. At a time when soaring drug prices are at the forefront of everyone's minds, approving what is likely to be a $300,000 placebo is not the right way forward.

Further reading:
http://blogs.sciencemag.org/pipeline/archives/2016/09/20/sarepta-gets-an-approval-unfortunately
https://www.statnews.com/pharmalot/2016/09/19/sarepta-wins-dmd-drug-approval/
http://endpts.com/senior-fda-officials-warned-that-eteplirsen-ok-would-lower-fda-standards/
 
Last edited:
  • Like
Likes   Reactions: atyy and Fervent Freyja
And, as there is some controversy about the clinical benefit, this is just the sort scenario for which accelerated approval was legislated. Congress set up accelerated approval to get potentially useful medications to those in dire need prior to proof of clinical efficacy. DMD is a serious condition. There is an unmet medical need. The surrogate endpoint, increased dystrophin production, was met albeit dystrophin was produced at a lower level than expected. Out of a cohort of 12 boys, two lost ambulation immediately after the start of the trial and the remaining boys are all still walking five years later in their mid-teens; a clinical benefit has not been statistically proven, but so far so good. This is an appropriate application of accelerated approval.

"The FDA instituted its Accelerated Approval Program to allow for earlier approval of drugs that treat serious conditions, and that fill an unmet medical need based on a surrogate endpoint. A surrogate endpoint is a marker, such as a laboratory measurement, radiographic image, physical sign or other measure that is thought to predict clinical benefit, but is not itself a measure of clinical benefit. The use of a surrogate endpoint can considerably shorten the time required prior to receiving FDA approval."

"Drug companies are still required to conduct studies to confirm the anticipated clinical benefit. These studies are known as phase 4 confirmatory trials. If the confirmatory trial shows that the drug actually provides a clinical benefit, then the FDA grants traditional approval for the drug. If the confirmatory trial does not show that the drug provides clinical benefit, FDA has regulatory procedures in place that could lead to removing the drug from the market."

http://www.fda.gov/Drugs/ResourcesForYou/HealthProfessionals/ucm313768.htm