- #1
Turkish
- 34
- 0
Homework Statement
5. What is the coding region of the sequence obtained i.e. bases ?? to ?? and what is the name of the gene
Homework Equations
Sequence A
atggcaacaaatatccgaaaaactcacccgctcctta
Sequence B
catcacctcacttgagaacaaacttctctataaatact
The Attempt at a Solution
Basically I am on the NCBI website - did a nucleotide blast, Now I did a CTRL+F to find the start and end of both sequence A and B however I can't seem to answer question 6 (above) It's probably easy but I havnt turned up to any of the biotech lectures... Thanks :)