Mechanism to allow for evolution. How did this mechanism come to be?

Click For Summary

Discussion Overview

The discussion revolves around the mechanisms that enable evolution, questioning whether such mechanisms pre-exist and how they originated. Participants explore the concepts of mutation, natural selection, and genetic variation, as well as the philosophical implications of these mechanisms in the context of evolutionary theory.

Discussion Character

  • Exploratory
  • Debate/contested
  • Conceptual clarification

Main Points Raised

  • Some participants propose that evolution requires a pre-existing mechanism to facilitate gradual changes in organisms over time.
  • Others suggest that mutation and natural selection serve as valid mechanisms for evolution, questioning how mutations arise naturally.
  • A participant raises the philosophical nature of questions regarding the origin of mechanisms like gravity, while others argue that the mutational mechanism is a scientific inquiry.
  • There is a discussion about the distinction between mutational mechanisms and natural selection, with some asserting that they are fundamentally different processes.
  • Some participants argue that changes in the genome due to mutations are inevitable and intrinsic to the world, while natural selection operates without special implementation.
  • Concerns are raised about the applicability of natural selection to non-organisms, such as rocks, and whether evolution can occur at the genetic level without living organisms.
  • Participants discuss the concept of "non-ideality of the world" in relation to mutations and the mechanisms of evolution.

Areas of Agreement / Disagreement

Participants express multiple competing views regarding the mechanisms of evolution, with no consensus reached on the nature of these mechanisms or their origins.

Contextual Notes

Participants highlight limitations in understanding the relationship between mutation and natural selection, as well as the philosophical implications of their origins. There are unresolved questions about the definitions and implications of terms like "non-ideality of the world."

vectorcube
Messages
317
Reaction score
0
Well, if we say that evolution is some gradual change of an organism from some form S to S* over a period of time. should there be some mechanism already in place to even allow evolution to occur?

To be even more clear.

For organism of form S, and successive generations S* , S**, S***...

S-> S*-> S**- >S***

such that each "->" means the gradual changes over a period of time. Should it not be the case that there exist a mechanism that "pre-exist" to allow the gradual change of organism from some form to another form over a certain period of time? If such mechanism exist, then how did this mechanism come to be what it is in the first place?


To be even more clear. Suppose you are given a series of printouts, and told that these printouts are all related in some way. Each printout is ordered( eg: printout 1, printout 2 ...) A guy by the name of DawinG comes along, and tell everyone that each handout is related to the previous handout by an computer algorithm. One can ask how did the printout come to be what it is by an appeal to the existence of a computer implementing an algorithm. I would say this computer+algorithm is the mechanism by which the evolution of printouts come to be what it is.
 
Last edited:
Biology news on Phys.org
vectorcube said:
Well, if we say that evolution is some gradual change of an organism from some form S to S* over a period of time. should there be some mechanism already in place to even allow evolution to occur?

To be even more clear. For organism of form S, and successive generations S* , S**, S***...

S-> S*-> S**- >S***

such that each "->" means the gradual changes over a period of time. Should it not be the case that there exist a mechanism that "pre-exist" to allow the gradual change of organism from some form to another form over a certain period of time? If such mechanism exist, then how did this mechanism come to be what it is in the first place?

Seems like mutation + natural selection is a valid mechanism, no? How do mutations come about naturally? That would seem to be straightforward given our EM environment, at least.

And another mechanism would be genetic variation, like hair color, or the color of moths. The moth coloration example is a pretty classic example of short-term evolution, correct?
 
Last edited:
vectorcube said:
If such mechanism exist, then how did this mechanism come to be what it is in the first place?
How did gravity come to be? These are philosophical questions, not scientific ones.
 
berkeman said:
That would seem to be straightforward given our EM environment, at least.


What is "EM environment" mean? How precisely does it bring about this mechanism?
 
russ_watters said:
How did gravity come to be? These are philosophical questions, not scientific ones.


It is not. Asking for mutational mechanism that allow evolution to happen is a scientific question.
 
Last edited:
I don't think that I understand your question. What don't you understand about mutation and selection?
 
Monique said:
I don't think that I understand your question. What don't you understand about mutation and selection?

The hidden assumption in your last question is that i don ` t know about evolution. This begs the question of what i don ` t know about evolution?

Let me give you another try:

I am sure you agree that there is a genetic mechanism that allow natural selection to occur in terms of mutations in genes? Yes?

Well, i want to know how this mutational mechanism come about. How does it come to be what it is to allow evolution to happen?
 
Still I don't understand your point. You are talking about a mutational mechanism and natural selection interchangeably, while they are two very different things. DNA can mutate by a whole range of mechanisms. Some mutations are beneficial or detrimental for an organism, allowing for positive or negative selection in a population (think for instance about lactose tolerance). This mechanism is based on survival. There is also genetic drift (change in allele frequencie due to chance), if populations are isolated this genetic drift can cause them to become different from each other.
 
I would say both mechanisms involved are quite natural - ie they don't need to appear, they both are intrinsic to the world.

Changes in genome (mutations) are effect of the non ideality of the world - nothing is perfect, copying of information is not perfect either, so mutations are inevitable (this leads to a good question about whether the system implemented in our cells is not at some kind of optimum allowing species to ellastic enough to adapt to the environement, yet not allowing them to degenerate; but that's completely different thing).

Natural selection is a mechanism that doesn't require any special implementation. Whichever organism is better as something, will win over those inferior. That works even for non-organisms - when you have two competing chemical reactions, whichever is faster will consume more reagents and will have a better yield. That's the same.
 
  • #10
Still I don't understand your point. You are talking about a mutational mechanism and natural selection interchangeably,

No, they are not the samething. By mutational mechanism, i mean the mechanism that allows mutations at the level of genes between successive generations.

Ex: Suppose someone ask why a rock cannot reproduce, and evolve into some other form of a rock. Well, rocks can`t reproduce, because rocks don` t have things like cells, DNA etc that allows it to pass to the *next generation* of rocks. I say the rock do not have the mechanism in place to allow it to pass on it` s information to the next generation of rocks!
 
  • #11
Borek said:
I would say both mechanisms involved are quite natural - ie they don't need to appear, they both are intrinsic to the world.

Both of what?

Changes in genome (mutations) are effect of the non ideality of the world.


what is "non ideality of the world" mean?

Natural selection is a mechanism that doesn't require any special implementation.


Do you think rocks can have natural selection? You don` t think there is evolution at the level of genes? In the sense that there is a gradual change of a particular specie to another specie after some period of time. These two species would have different genetic information.

Natural selection is a mechanism that doesn't require any special implementation. Whichever organism is better as something, will win over those inferior.

But this definition presuppose at least one organism to be in place for natural selection to occur. How then did this organism come to be what it is?

"That works even for non-organisms - when you have two competing chemical reactions, whichever is faster will consume more reagents and will have a better yield. That's the same."

But non-organism cannot have evolution. A rock cannot evolve into a different form of rock.
 
Last edited:
  • #12
vectorcube said:
Both of what?

There are two things involved - mutations and natural selection. Call it mechanism, process, whatever - both of them are needed.

what is "non ideality of the world" mean?

That world is never ideal. For example there are no such things as ideal crystals - they always have some kinds of defects. There are no chemical reactions that can take only one path - there are always side ractions that lead to byproducts. And so on. It has nothing to do with life, it existed on the molecular lever since the first molcules appeared after BB.

Do you think rocks can have natural selection?

No, although there are theories that point at some kind of rocks as an early matrix involved in the reproduction of genes. But rocks don't reproduce, so their evolution is out of the question.

You don` t think there is evolution at the level of genes? In the sense that there is a gradual change of a particular specie to another specie after some period of time. These two species would have different genetic information.

Genes are involved in the evolution - but you are talking about evolution as it is occurring now. This is thing that evolved as well, starting from much simpler process, which get complicated with passing time. Principles are the same, biochemical details have changed.

But this definition presuppose at least one organism to be in place for natural selection to occur. How then did this organism come to be what it is?

"That works even for non-organisms - when you have two competing chemical reactions, whichever is faster will consume more reagents and will have a better yield. That's the same."

But non-organism cannot have evolution. A rock cannot evolve into a different form of rock.

You don't need organism to have a kind of evolution. Some kinds of RNA can replicate in vitro, AFAIR without a need of any other molecules but RNA itself and abundance of nucleotides. If you add heavy metal ions to such mixture, it will slow down the replication, nonethelss it will be still occurring. If you will separate reproduced RNA and repeat the procedure several times, each next generation replicates faster - RNA evolves and gets better at reproduction. Would you call it an organism?
 
  • #13
Genes are involved in the evolution - but you are talking about evolution as it is occurring now. This is thing that evolved as well, starting from much simpler process, which get complicated with passing time.


what is this "thing"? and what does this "thing" evolve from? Does this "thing" have genes?

biochemical details have changed


I don` t understand this.



You don't need organism to have a kind of evolution. Some kinds of RNA can replicate in vitro, AFAIR without a need of any other molecules but RNA itself and abundance of nucleotides.

But RNA would be some form of mechanism. How did this mechanism come about?


If you add heavy metal ions to such mixture, it will slow down the replication, nonethelss it will be still occurring. If you will separate reproduced RNA and repeat the procedure several times, each next generation replicates faster - RNA evolves and gets better at reproduction.


I generally consider RNA, DNA, cells etc to be necessary mechanism for evolutions to occur. If you could induce evolution of one RNA to another RNA. I suppose you can say RNA evolves.

Would you call it an organism?

I don ` t understand your example, so i really do not know. Let me be more precise.

If X evolve, then X is an organism. I don` t really care for the converse.
 
  • #14
Genetic information is key, if you have a strand of RNA it can mutate and its information content can change. This is where it starts. Did you read my signature?
 
  • #15
Monique said:
Genetic information is key, if you have a strand of RNA it can mutate and its information content can change. This is where it starts. Did you read my signature?

I understand what you are saying, but it seems to not be case the other way around.

Let me put it this way. If we say RNA is the key that allow organism to change. My question would be where did this RNA come from? Same with any mechanism you can name.
 
  • #16
Vector cube, see if I've understood your question right.
For eg., consider the situation at which some organism first evolved eyes. You say there should have been some mechanism that resulted in or triggered the mutation of an existent gene or development of a new gene that then carried the code for the construction and fuction of the eyes. Am i right in understanding what you say?
 
  • #17
sganesh88 said:
Vector cube, see if I've understood your question right.
For eg., consider the situation at which some organism first evolved eyes. You say there should have been some mechanism that resulted in or triggered the mutation of an existent gene or development of a new gene that then carried the code for the construction and fuction of the eyes. Am i right in understanding what you say?


I would not think of such mechanism as causing, or triggering something to happen. I would think of the mechanism as a pre-condition that allows mutation to occur. Similarly, I would say the computer hardcare is the precondition that allows the computer to output anything.
 
  • #18
"allowing" doesn't make sense. As if the print out wants to come out and the computer is kind enough to "allow" it. The computer through its program lines and memory; and the printer through its hardware work jointly causing the paper to filled with some words.
 
  • #19
vectorcube said:
I would not think of such mechanism as causing, or triggering something to happen. I would think of the mechanism as a pre-condition that allows mutation to occur. Similarly, I would say the computer hardcare is the precondition that allows the computer to output anything.

So your question is how the first strand of replicating information came to be? With "mechanism" you mean genetic information?
 
  • #20
sganesh88 said:
"allowing" doesn't make sense. As if the print out wants to come out and the computer is kind enough to "allow" it. The computer through its program lines and memory; and the printer through its hardware work jointly causing the paper to filled with some words.


Maybe "allowing" is the wrong word. A better word might be "necessary condition". A computer is a necessary condition to have computer printouts.
 
Last edited:
  • #21
Monique said:
So your question is how the first strand of replicating information came to be?



i don ` t know what is replicating information mean.

If by "replicating informatio"n, it means something like an computer algorithm, then the physical thing, or "computer" is the mechanism that implements the algorithm.




Code:
With "mechanism"  you mean genetic information?


I mean "mechanism" as something that i can conceivable see with my own eyes. Can you tell me how i can see "genetic information"?
 
  • #22
^^ Which just means that it is "one of the causes" for the print out.
 
  • #23
sganesh88 said:
^^ Which just means that it is "one of the causes" for the print out.

No. It is not cause. It is a "necessary condition".
For example: For X to fall from height H. It is a necessary condition that X be in H.
 
  • #24
vectorcube said:
I mean "mechanism" as something that i can conceivable see with my own eyes. Can you tell me how i can see "genetic information"?
Metaphorical: as beads on a string. Below are two sequences of genetic information coding for the same protein but in two different organisms. The sequences are highly related, but are not identical.

human:
ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA

mouse:
ATGGCTGATCAGCTGACTGAAGAGCAGATTGCTGAATTCAAGGAAGCTTTCTCCCTATTCGATAAAGATGGTGACGGCACCATCACAACCAAGGAACTGGGGACCGTCATGCGGTCACTGGGTCAGAACCCAACAGAAGCCGAGCTGCAGGATATGATCAACGAAGTGGATGCTGATGGCAATGGCACCATTGACTTCCCAGAGTTCTTGACTATGATGGCTAGAAAAATGAAAGACACAGATAGCGAAGAAGAGATCCGCGAGGCCTTCCGAGTGTTTGACAAGGATGGGAATGGTTACATCAGTGCGGCAGAACTGCGCCACGTCATGACAAACTTAGGAGAAAAGCTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGCGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA
 
  • #25
vectorcube said:
I don` t understand this.

vectorcube said:
I don ` t understand your example, so i really do not know.

vectorcube said:
i don ` t know what is replicating information mean.

Sorry, but you can't fight a war having no ammunition :wink:

I suppose that at the moment your ability to understand the evolution is limited by your knowledge - you know only some pieces, and you are trying to build something that requires other pieces. Nothing wrong about it, but it won't lead you far. Try to learn a little more about the biology or reproduction and biochemistry behind (even reading wikipedia can be enough), that'll give us a common ground for discussion.
 
  • #26
It is my understanding that the word "mechanism" means a description of the process by which a natural phenomena happens. Ie, the mechanism of combustion is the chemistry of combining a fuel with oxygen. Is this what you are driving at?y
 
  • #27
I believe what Vectorcube is getting at is, "How did the complex come to be from the simple?" Can evolution explain how DNA came into being if only mutation and selection are parameters? Mutation and selection are sufficient to explain how a massively complex system (like DNA) can demonstrate variability over time but is it sufficient to explain how it came into existence de novo? If that is your question, then I think the answer is that no one knows for sure.

I recommend that you dedicate your professional career to this question. I'm certainly interested in having it explained to me.
 
  • #28
chemisttree said:
"How did the complex come to be from the simple?"

Sounds like irreducible complexity problem to me now :smile:
 
  • #29
I wouldn't really describe mutation as a 'mechanism'...it's just an error that occurs randomly.

What I would describe as a 'mechanism' though is the proof-reading done to correct for mutations.
 
  • #30
BoomBoom said:
I wouldn't really describe mutation as a 'mechanism'...it's just an error that occurs randomly.
That is not true, mutations can occur through different mechanisms (tautomerisation, depurination, deamination, chemical or UV-induced mutations, replication errors) and there can be a bias towards a certain base change or area in the genome.
 

Similar threads

  • · Replies 5 ·
Replies
5
Views
2K
  • · Replies 2 ·
Replies
2
Views
4K
  • · Replies 4 ·
Replies
4
Views
3K
Replies
3
Views
2K
  • · Replies 138 ·
5
Replies
138
Views
18K
  • · Replies 6 ·
Replies
6
Views
4K
  • · Replies 1 ·
Replies
1
Views
33K
  • · Replies 1 ·
Replies
1
Views
3K
  • · Replies 8 ·
Replies
8
Views
3K
  • · Replies 16 ·
Replies
16
Views
4K