Mechanism to allow for evolution. How did this mechanism come to be?

  • Thread starter vectorcube
  • Start date
  • #26
russ_watters
Mentor
19,781
6,187
It is my understanding that the word "mechanism" means a description of the process by which a natural phenomena happens. Ie, the mechanism of combustion is the chemistry of combining a fuel with oxygen. Is this what you are driving at?y
 
  • #27
chemisttree
Science Advisor
Homework Helper
Gold Member
3,447
483
I believe what Vectorcube is getting at is, "How did the complex come to be from the simple?" Can evolution explain how DNA came into being if only mutation and selection are parameters? Mutation and selection are sufficient to explain how a massively complex system (like DNA) can demonstrate variability over time but is it sufficient to explain how it came in to existence de novo? If that is your question, then I think the answer is that no one knows for sure.

I recommend that you dedicate your professional career to this question. I'm certainly interested in having it explained to me.
 
  • #28
Borek
Mentor
28,501
2,914
"How did the complex come to be from the simple?"
Sounds like irreducible complexity problem to me now :smile:
 
  • #29
166
1
I wouldn't really describe mutation as a 'mechanism'....it's just an error that occurs randomly.

What I would describe as a 'mechanism' though is the proof-reading done to correct for mutations.
 
  • #30
Monique
Staff Emeritus
Science Advisor
Gold Member
4,149
64
I wouldn't really describe mutation as a 'mechanism'....it's just an error that occurs randomly.
That is not true, mutations can occur through different mechanisms (tautomerisation, depurination, deamination, chemical or UV-induced mutations, replication errors) and there can be a bias towards a certain base change or area in the genome.
 
  • #31
Borek
Mentor
28,501
2,914
That is not true, mutations can occur through different mechanisms (tautomerisation, depurination, deamination, chemical or UV-induced mutations, replication errors) and there can be a bias towards a certain base change or area in the genome.
Reasons and details can be different, but I think these can be all still classified as random errors. Even if there is some kind of bias it just means that statistical distribution is somehow skewed - but it is still random. That's what I called non-ideality earlier.
 
  • #32
299
0
Metaphorical: as beads on a string. Below are two sequences of genetic information coding for the same protein but in two different organisms. The sequences are highly related, but are not identical.

human:
ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA

mouse:
ATGGCTGATCAGCTGACTGAAGAGCAGATTGCTGAATTCAAGGAAGCTTTCTCCCTATTCGATAAAGATGGTGACGGCACCATCACAACCAAGGAACTGGGGACCGTCATGCGGTCACTGGGTCAGAACCCAACAGAAGCCGAGCTGCAGGATATGATCAACGAAGTGGATGCTGATGGCAATGGCACCATTGACTTCCCAGAGTTCTTGACTATGATGGCTAGAAAAATGAAAGACACAGATAGCGAAGAAGAGATCCGCGAGGCCTTCCGAGTGTTTGACAAGGATGGGAATGGTTACATCAGTGCGGCAGAACTGCGCCACGTCATGACAAACTTAGGAGAAAAGCTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGCGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA


Ok, then no. genetic information is not the mechanism. The mechanism has to be "physical"( i can conceivable see), and it has to be such that it would allow micro-evoluation to happen in a way the a computer is the mechanism that carries out a computation.
 
  • #33
299
0
Sorry, but you can't fight a war having no ammunition :wink:

I suppose that at the moment your ability to understand the evolution is limited by your knowledge - you know only some pieces, and you are trying to build something that requires other pieces. Nothing wrong about it, but it won't lead you far. Try to learn a little more about the biology or reproduction and biochemistry behind (even reading wikipedia can be enough), that'll give us a common ground for discussion.

Well, my question is very simple, and does not require specialized knowledge. Again, i am asking for the minimum initial physical condition that as to be in place to allow life to evolution from generation to generation. I am not talking about non-life.
 
  • #34
Borek
Mentor
28,501
2,914
Ok, then no. genetic information is not the mechanism. The mechanism has to be "physical"( i can conceivable see), and it has to be such that it would allow micro-evoluation to happen in a way the a computer is the mechanism that carries out a computation.
You can't dictate reality how it has to act. At best you can research reality to understand it.
 
  • #35
299
0
It is my understanding that the word "mechanism" means a description of the process by which a natural phenomena happens. Ie, the mechanism of combustion is the chemistry of combining a fuel with oxygen. Is this what you are driving at?y
That is good enough for me. I like your example. So the "mechanism" of combustion is it` s chemistry. My question is what is the "minimum" mechanism that is required to allow micro-level evolution to occur. How did this minimum mechanism come it be what it is?
 
  • #36
299
0
I believe what Vectorcube is getting at is, "How did the complex come to be from the simple?" Can evolution explain how DNA came into being if only mutation and selection are parameters? Mutation and selection are sufficient to explain how a massively complex system (like DNA) can demonstrate variability over time but is it sufficient to explain how it came in to existence de novo? If that is your question, then I think the answer is that no one knows for sure.
I think you understand my idea. Evolution allow organism to change from one form to the next, but it seems to me that there is still a minimun necessary condition to require for evolution to even happen.
 
  • #37
299
0
You can't dictate reality how it has to act. At best you can research reality to understand it.
My own feeling is that the solution is in physics. Maybe some initial configuration of molculars are configurated in such a way that provide "minimum necessary condition" to allow micro -evolution to happen.
 
  • #38
Monique
Staff Emeritus
Science Advisor
Gold Member
4,149
64
You are making absolutely no sense. The minimal condition is that you need to have a molecule that can be arranged in multiple ways so that it can contain information. This is all based on (bio)chemistry.
 
  • #39
140
1
I don't even think your question is about evolution, as it's already been explained how evolution works. Instead I think you are asking how first life came to be. Once we have life mutations, natural selection take over.
 
  • #40
166
1
My question is what is the "minimum" mechanism that is required to allow micro-level evolution to occur.
How about (DNA/RNA) replication with variation....
 
  • #41
russ_watters
Mentor
19,781
6,187
That is good enough for me. I like your example. So the "mechanism" of combustion is it` s chemistry. My question is what is the "minimum" mechanism that is required to allow micro-level evolution to occur. How did this minimum mechanism come it be what it is?
So then your question is the same as asking how chemistry came to be. At best, that's an improper question, since the laws of chemistry are built-in to the universe. They didn't "come to be", they just are. And if you want to go any deeper than that, then we're back to what I said before: this isn't science, it is philosophy.

And by the way, the mechanisms of genetic change are covered by chemistry as well. So it's actually the exact same question as asking how the chemistry of fire came to be.
 
Last edited:
  • #42
299
0
The minimal condition is that you need to have a molecule that can be arranged in multiple ways so that it can contain information. This is all based on (bio)chemistry.
Then where do this minimal condition come from? ( and don`t say evolution)
You do realize that am i asking for the minumum condition that needs to be in place for evolution to even happen, so you can ` t use evolution to explain the existence of this molecule.
 
  • #43
299
0
I don't even think your question is about evolution, as it's already been explained how evolution works. Instead I think you are asking how first life came to be. Once we have life mutations, natural selection take over.
Yes, i think my question very closer to the orgin of life, but i think my question is more specific. I am asking for the necessary conditions that had to be in place to even alot natural selection to take over.
 
  • #44
299
0
How about (DNA/RNA) replication with variation....

Suppose we go way back to this original DNA/RNA, then where did it come from? ( obviously, it can` t be from another DNA/RNA, since it is the first).
 
  • #45
Monique
Staff Emeritus
Science Advisor
Gold Member
4,149
64
What is the minimal condition of chemistry? It's molecules being able to react with each other. You might as well be asking the minimum condition that needs to be in place for the universe to be here.
 
  • #46
299
0
So then your question is the same as asking how chemistry came to be. At best, that's an improper question, since the laws of chemistry are built-in to the universe. They didn't "come to be", they just are. And if you want to go any deeper than that, then we're back to what I said before: this isn't science, it is philosophy.

And by the way, the mechanisms of genetic change are covered by chemistry as well. So it's actually the exact same question as asking how the chemistry of fire came to be.

If the original necessary condition for natural selection is some particular molecule( say C), then i guess it is related to chemistry. A plausible answer might take of from of how a particular molecule A come to arrange itself with molecule B etc..to get some molecule C such that C is this minimal condition necessary for natural selection etc. I don` t really see how this is a philosophical question.

Perhaps what you have in mind in the next question. Why do molecules behave the way they do according to rules of chemical formules. If so, then even that is not a philosophical for i can conceivable explain why chemical formulas work because of some underlying physics( E.g: quantum mechanics).
 
  • #48
299
0
You might as well be asking the minimum condition that needs to be in place for the universe to be here.
See post 46. Russ had a similar comment. Even if the key lies in some particular molecules( Say C). One can still see this as a scientific question, because one can explain the existence of C by some molecules A, and B, and how they interact to produce C.

It's molecules being able to react with each other.
It is also how they interact. I can conceivable think up many ways for two things to interact, but there is only one way for nature to act the way it does.
 
  • #49
Borek
Mentor
28,501
2,914
there is only one way for nature to act the way it does.
That's speculation. We know only one way nature acts, that doesn't mean other ways don't exist.
 
  • #50
Monique
Staff Emeritus
Science Advisor
Gold Member
4,149
64
I suggest you pick up a science book, come back when you've read up on the very basic concepts of physics, chemistry and biology. You seem to be lacking a very basic understanding of what we know about the world today.
 

Related Threads on Mechanism to allow for evolution. How did this mechanism come to be?

  • Last Post
2
Replies
26
Views
18K
Replies
4
Views
2K
Replies
9
Views
6K
  • Last Post
Replies
4
Views
2K
  • Last Post
Replies
2
Views
4K
Replies
23
Views
16K
Replies
8
Views
4K
  • Last Post
Replies
4
Views
16K
  • Last Post
Replies
1
Views
5K
Replies
16
Views
6K
Top