Mechanism to allow for evolution. How did this mechanism come to be?

Click For Summary

Discussion Overview

The discussion revolves around the mechanisms that enable evolution, questioning whether such mechanisms pre-exist and how they originated. Participants explore the concepts of mutation, natural selection, and genetic variation, as well as the philosophical implications of these mechanisms in the context of evolutionary theory.

Discussion Character

  • Exploratory
  • Debate/contested
  • Conceptual clarification

Main Points Raised

  • Some participants propose that evolution requires a pre-existing mechanism to facilitate gradual changes in organisms over time.
  • Others suggest that mutation and natural selection serve as valid mechanisms for evolution, questioning how mutations arise naturally.
  • A participant raises the philosophical nature of questions regarding the origin of mechanisms like gravity, while others argue that the mutational mechanism is a scientific inquiry.
  • There is a discussion about the distinction between mutational mechanisms and natural selection, with some asserting that they are fundamentally different processes.
  • Some participants argue that changes in the genome due to mutations are inevitable and intrinsic to the world, while natural selection operates without special implementation.
  • Concerns are raised about the applicability of natural selection to non-organisms, such as rocks, and whether evolution can occur at the genetic level without living organisms.
  • Participants discuss the concept of "non-ideality of the world" in relation to mutations and the mechanisms of evolution.

Areas of Agreement / Disagreement

Participants express multiple competing views regarding the mechanisms of evolution, with no consensus reached on the nature of these mechanisms or their origins.

Contextual Notes

Participants highlight limitations in understanding the relationship between mutation and natural selection, as well as the philosophical implications of their origins. There are unresolved questions about the definitions and implications of terms like "non-ideality of the world."

  • #31
Monique said:
That is not true, mutations can occur through different mechanisms (tautomerisation, depurination, deamination, chemical or UV-induced mutations, replication errors) and there can be a bias towards a certain base change or area in the genome.

Reasons and details can be different, but I think these can be all still classified as random errors. Even if there is some kind of bias it just means that statistical distribution is somehow skewed - but it is still random. That's what I called non-ideality earlier.
 
Biology news on Phys.org
  • #32
Monique said:
Metaphorical: as beads on a string. Below are two sequences of genetic information coding for the same protein but in two different organisms. The sequences are highly related, but are not identical.

human:
ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA

mouse:
ATGGCTGATCAGCTGACTGAAGAGCAGATTGCTGAATTCAAGGAAGCTTTCTCCCTATTCGATAAAGATGGTGACGGCACCATCACAACCAAGGAACTGGGGACCGTCATGCGGTCACTGGGTCAGAACCCAACAGAAGCCGAGCTGCAGGATATGATCAACGAAGTGGATGCTGATGGCAATGGCACCATTGACTTCCCAGAGTTCTTGACTATGATGGCTAGAAAAATGAAAGACACAGATAGCGAAGAAGAGATCCGCGAGGCCTTCCGAGTGTTTGACAAGGATGGGAATGGTTACATCAGTGCGGCAGAACTGCGCCACGTCATGACAAACTTAGGAGAAAAGCTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGCGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA



Ok, then no. genetic information is not the mechanism. The mechanism has to be "physical"( i can conceivable see), and it has to be such that it would allow micro-evoluation to happen in a way the a computer is the mechanism that carries out a computation.
 
  • #33
Borek said:
Sorry, but you can't fight a war having no ammunition :wink:

I suppose that at the moment your ability to understand the evolution is limited by your knowledge - you know only some pieces, and you are trying to build something that requires other pieces. Nothing wrong about it, but it won't lead you far. Try to learn a little more about the biology or reproduction and biochemistry behind (even reading wikipedia can be enough), that'll give us a common ground for discussion.


Well, my question is very simple, and does not require specialized knowledge. Again, i am asking for the minimum initial physical condition that as to be in place to allow life to evolution from generation to generation. I am not talking about non-life.
 
  • #34
vectorcube said:
Ok, then no. genetic information is not the mechanism. The mechanism has to be "physical"( i can conceivable see), and it has to be such that it would allow micro-evoluation to happen in a way the a computer is the mechanism that carries out a computation.

You can't dictate reality how it has to act. At best you can research reality to understand it.
 
  • #35
russ_watters said:
It is my understanding that the word "mechanism" means a description of the process by which a natural phenomena happens. Ie, the mechanism of combustion is the chemistry of combining a fuel with oxygen. Is this what you are driving at?y

That is good enough for me. I like your example. So the "mechanism" of combustion is it` s chemistry. My question is what is the "minimum" mechanism that is required to allow micro-level evolution to occur. How did this minimum mechanism come it be what it is?
 
  • #36
chemisttree said:
I believe what Vectorcube is getting at is, "How did the complex come to be from the simple?" Can evolution explain how DNA came into being if only mutation and selection are parameters? Mutation and selection are sufficient to explain how a massively complex system (like DNA) can demonstrate variability over time but is it sufficient to explain how it came into existence de novo? If that is your question, then I think the answer is that no one knows for sure.

I think you understand my idea. Evolution allow organism to change from one form to the next, but it seems to me that there is still a minimun necessary condition to require for evolution to even happen.
 
  • #37
Borek said:
You can't dictate reality how it has to act. At best you can research reality to understand it.

My own feeling is that the solution is in physics. Maybe some initial configuration of molculars are configurated in such a way that provide "minimum necessary condition" to allow micro -evolution to happen.
 
  • #38
You are making absolutely no sense. The minimal condition is that you need to have a molecule that can be arranged in multiple ways so that it can contain information. This is all based on (bio)chemistry.
 
  • #39
I don't even think your question is about evolution, as it's already been explained how evolution works. Instead I think you are asking how first life came to be. Once we have life mutations, natural selection take over.
 
  • #40
vectorcube said:
My question is what is the "minimum" mechanism that is required to allow micro-level evolution to occur.

How about (DNA/RNA) replication with variation...
 
  • #41
vectorcube said:
That is good enough for me. I like your example. So the "mechanism" of combustion is it` s chemistry. My question is what is the "minimum" mechanism that is required to allow micro-level evolution to occur. How did this minimum mechanism come it be what it is?
So then your question is the same as asking how chemistry came to be. At best, that's an improper question, since the laws of chemistry are built-in to the universe. They didn't "come to be", they just are. And if you want to go any deeper than that, then we're back to what I said before: this isn't science, it is philosophy.

And by the way, the mechanisms of genetic change are covered by chemistry as well. So it's actually the exact same question as asking how the chemistry of fire came to be.
 
Last edited:
  • #42
Monique said:
The minimal condition is that you need to have a molecule that can be arranged in multiple ways so that it can contain information. This is all based on (bio)chemistry.

Then where do this minimal condition come from? ( and don`t say evolution)
You do realize that am i asking for the minumum condition that needs to be in place for evolution to even happen, so you can ` t use evolution to explain the existence of this molecule.
 
  • #43
darkhorror said:
I don't even think your question is about evolution, as it's already been explained how evolution works. Instead I think you are asking how first life came to be. Once we have life mutations, natural selection take over.

Yes, i think my question very closer to the orgin of life, but i think my question is more specific. I am asking for the necessary conditions that had to be in place to even a lot natural selection to take over.
 
  • #44
BoomBoom said:
How about (DNA/RNA) replication with variation...


Suppose we go way back to this original DNA/RNA, then where did it come from? ( obviously, it can` t be from another DNA/RNA, since it is the first).
 
  • #45
What is the minimal condition of chemistry? It's molecules being able to react with each other. You might as well be asking the minimum condition that needs to be in place for the universe to be here.
 
  • #46
russ_watters said:
So then your question is the same as asking how chemistry came to be. At best, that's an improper question, since the laws of chemistry are built-in to the universe. They didn't "come to be", they just are. And if you want to go any deeper than that, then we're back to what I said before: this isn't science, it is philosophy.

And by the way, the mechanisms of genetic change are covered by chemistry as well. So it's actually the exact same question as asking how the chemistry of fire came to be.


If the original necessary condition for natural selection is some particular molecule( say C), then i guess it is related to chemistry. A plausible answer might take of from of how a particular molecule A come to arrange itself with molecule B etc..to get some molecule C such that C is this minimal condition necessary for natural selection etc. I don` t really see how this is a philosophical question.

Perhaps what you have in mind in the next question. Why do molecules behave the way they do according to rules of chemical formules. If so, then even that is not a philosophical for i can conceivable explain why chemical formulas work because of some underlying physics( E.g: quantum mechanics).
 
  • #48
Monique said:
You might as well be asking the minimum condition that needs to be in place for the universe to be here.

See post 46. Russ had a similar comment. Even if the key lies in some particular molecules( Say C). One can still see this as a scientific question, because one can explain the existence of C by some molecules A, and B, and how they interact to produce C.

It's molecules being able to react with each other.

It is also how they interact. I can conceivable think up many ways for two things to interact, but there is only one way for nature to act the way it does.
 
  • #49
vectorcube said:
there is only one way for nature to act the way it does.

That's speculation. We know only one way nature acts, that doesn't mean other ways don't exist.
 
  • #50
I suggest you pick up a science book, come back when you've read up on the very basic concepts of physics, chemistry and biology. You seem to be lacking a very basic understanding of what we know about the world today.
 
  • #51
Borek said:


Nucleotides are the fundamental molecules that combine in series to form RNA ... RNA is made of long stretches of specific nucleotides arranged so that their sequence of bases carries information. The RNA world hypothesis holds that in the primordial soup/primordial sandwich, there existed free-floating nucleotides. These nucleotides regularly formed bonds with one another, which often broke because the change in energy was so low. However, certain sequences of base pairs have catalytic properties that lower the energy of their chain being created, causing them to stay together for longer periods of time. As each chain grew longer, it attracted more matching nucleotides faster, causing chains to now form faster than they were breaking down.

These chains are proposed as the first, primitive forms of life.


&

The RNA World hypothesis is supported by RNA's ability to store, transmit, and duplicate genetic information, as DNA does.


Just what i am looking for, thanks

The answer is:

1. The original necessary condition( ie: mechanism) for natural selection is the RNA( or pre-RNA).

2. RNA come to be what it is by the chaining of many Nucleotides where each Nucleotides interact according to the rules of chemistry.


Does anyone have anything to add to 1 and 2?
 
Last edited:
  • #52
Only http://en.wikipedia.org/wiki/Iron-sulfur_world_theory"

As of 2009, no one has yet synthesized a "protocell" using basic components which would have the necessary properties of life (the so-called "bottom-up-approach"). Without such a proof-of-principle, explanations have tended to be short on specifics. However, some researchers are working in this field, notably Steen Rasmussen at Los Alamos National Laboratory and Jack Szostak at Harvard University. Others have argued that a "top-down approach" is more feasible. One such approach, attempted by Craig Venter and others at The Institute for Genomic Research, involves engineering existing prokaryotic cells with progressively fewer genes, attempting to discern at which point the most minimal requirements for life were reached. The biologist John Desmond Bernal, coined the term Biopoesis for this process, and suggested that there were a number of clearly defined "stages" that could be recognised in explaining the origin of life.

Stage 1: The origin of biological monomers
Stage 2: The origin of biological polymers
Stage 3: The evolution from molecules to cell
Bernal suggested that evolution may have commenced early, some time between Stage 1 and 2.
Does that sound like the direction you want to go?
 
Last edited by a moderator:
  • #53
I have trouble accepting a 'chance-event' theory for the origin of life and even this 'errors in DNA and inheritance through NS' one to explain the evolution of complex organs like eye. Clumping of amino acids, formation of nucleic acids.., ah hell! Do these explain the beauties in life like humor, mad love for rain, music or other forms of art? I guess an explanation, an evolutionist would give me is "Those are to increase your chance of survival". Pathetic one, if he does say so.


P.S: No. I don't intend to bring in God here; so don't make that face!
P.P.S: Is it just me or is there anyone among you guys who feel the same way? (religious fanatics need not apply for membership! )
 
  • #54
sganesh88 said:
P.P.S: Is it just me or is there anyone among you guys who feel the same way? (religious fanatics need not apply for membership! )

As long as you have not provided alternate explanation, Ockham's razor keeps us on the evolutionary path.
 
  • #55
I don't have one. But i do, for sure, know there is a better and beautiful one waiting to replace this. And Ockham's razor cannot come into picture this soon as we don't know the degree of simplicity of the competing theory, non-existent as yet.
 
  • #56
If you are asking about the origin of life, you should know that evolution is a SEPARATE discussion from that. Evolution deals with the natural or artificial variation within a complex system selected for survival by some "advantage".

Life from non life is not evolution.
 
  • #57
sganesh88 said:
I don't have one. But i do, for sure, know there is a better and beautiful one waiting to replace this.

:smile:

Evolution theory will continue to be refined/detailed (as it has over the last century) as more is learned of the details of complex biological systems, but I find it hard to believe it would ever be "replaced" by anything. The only competing theory it has is religion...

There is nothing "better" or more "beautiful"...
 
  • #58
Galilean transformation was slightly refined by Lorentz's. But we have a new theory called SR bringing in lot of implications. I think a similar modification of a postulate of the theory of evolution will come in the future.

"There is nothing better or more beautiful"
A mad fight for survival,off spring production and species propagation, proposed by evolution, is what you call beautiful? Fine then.
 
  • #59
Borek said:
Whichever organism is better as something, will win over those inferior. That works even for non-organisms - when you have two competing chemical reactions, whichever is faster will consume more reagents and will have a better yield. That's the same.
I don't think it is about what is better in all cases. For example blue eyes and blonde hair in northern climates I am not convinced is because of it being better for sunlight. Otherwise people in Greenland would be blonde with blue eyes since those people up there would choose partners with lighter skin and lighter eyes. Similarly, a man doesn't choose a woman with medium breasts because those medium breasts will be better at breastfeeding than smaller ones, he chooses it because of... a human made up in the mind psychological biased stupidity. Nature is not about what is better - it's more about whatever something chose, for whatever reasons.. not necessarily best reasons. If dark skin and brown eyes were truly harmful in northern climates, then the greenlanders with dark skin (nearly all of them) would have all sorts of diseases due to them not being able to handle sunlight, and they would not be breeding for the better since their country is full of dark skin.

As for something having the best chemical reaction - the whole universe could easily blow up and continually blow up like an atomic bomb, with the "Best" reaction. Why are there points of great stability all around us.

It depends what you define as "best" or "Better" too - and subjective things are not really scientific. If best and better are defined by personal opinions and man made ideas, that is quackery. Nature would not know of any "better" or "best" or even "worst" for that matter. If a human found that a curvy body looked better and therefore chose it for replicating more children, this does not actually make it true that it's "better" for the environment. It is just our man made idea that it's better, which could very well be wrong. Possibly a large square body is actually better statistically than a curvy body, for having children, as an example. Our man made idea of "better" might help us "think" we are better, in our mind, but if nature doesn't differentiate between better or worse (an asteroid hits the Earth - is this better for nature or worse?) then how is "Better" even relevant. So if humans are choosing partners based on assumptions and speculations, and since humans are an example of nature "selecting", and since humans make choices for partners that are not actually better choices, how can natural selection always be about what is better and what is superior? Often it's just about "what the organism chose for silly convenient reasons" but not "Better" ones.
 
Last edited:
  • #60
physical1 said:
I don't think it is about what is better in all cases. For example blue eyes and blonde hair in northern climates I am not convinced is because of it being better for sunlight. Otherwise people in Greenland would be blonde with blue eyes

If you have not noticed - people living north are blondes with light skin. That's not accidental, that's adaptation to the lack of Sun necessary for Vit D metabolism.

Similarly, a man doesn't choose a woman with medium breasts because those medium breasts will be better at breastfeeding than smaller ones, he chooses it because of... a human made up in the mind psychological biased stupidity.

I don't remember correct name, but some traits are effect of what can be classified as cultural preferences. It doesn't require culture per se, as it happen in animals as well.

Nature is not about what is better - it's more about whatever something chose, for whatever reasons.. not necessarily best reasons.

In most cases choice is done automatically - if you are slow cheetah, you will starve to death. If you are slow antelope, you will be eaten by lame cheetah. In both cases you will not leave any progeny and you will be automatically eliminated. Same happens if you can run fast, but chose to run slowly for whatever reason.

If dark skin and brown eyes were truly harmful in northern climates, then the greenlanders with dark skin (nearly all of them) would have all sorts of diseases due to them not being able to handle sunlight, and they would not be breeding for the better since their country is full of dark skin.

AFAIR kids of dark skin people living far to the north have rickets much more often than those blonde greenlanders. I think black kids in Swedish kindergartens ar treated in some special way - more Vit D, more UV baths - just to avoid problems.

As for something having the best chemical reaction - the whole universe could easily blow up and continually blow up like an atomic bomb, with the "Best" reaction. Why are there points of great stability all around us.

Because there is never enough resources.

It depends what you define as "best" or "Better" too - and subjective things are not really scientific. If best and better are defined by personal opinions and man made ideas, that is quackery. Nature would not know of any "better" or "best" or even "worst" for that matter.

Perhaps better is not the best word, perhaps "best fitted" will be better. But the mechanism is still the same - those having an advantage win over those without and replace them in population.
 

Similar threads

  • · Replies 5 ·
Replies
5
Views
3K
  • · Replies 2 ·
Replies
2
Views
4K
  • · Replies 4 ·
Replies
4
Views
3K
Replies
3
Views
2K
  • · Replies 138 ·
5
Replies
138
Views
18K
  • · Replies 6 ·
Replies
6
Views
4K
  • · Replies 1 ·
Replies
1
Views
33K
  • · Replies 1 ·
Replies
1
Views
3K
  • · Replies 8 ·
Replies
8
Views
3K
  • · Replies 16 ·
Replies
16
Views
4K